miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST040699
species: Medicago truncatula
miRNA family: MIR171_1
source: miRBase, original name: mtr-MIR171e (MI0005620)

Taxonomy by NCBI:
Medicago truncatula Medicago Trifolieae Papilionoideae Fabaceae Fabales fabids rosids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
AGATTGAGCCGCGCCAATATC

miRNA*
TGTTGGTGAGGTTCAATCCGA

mismatches: 2
bulges: 0

View larger
pre-miRNA
AAAGCGATGTTGGTGAGGTTCAATCCGAAGACGGATTTACATGTATAGAGTTGTAAAATACGATCTCAGATTGAGCCGCGCCAATATCACTTT

dot-bracket secondary structure
((((.((((((((((.(((((((((.((.((((..((((((..........))))))...)).)))).))))))))).)))))))))).))))


SIMILARITIES
miRBase tcc-MIR171c: 6e-33

PMRD ptc-miRf10509-akr: 2e-32

microPC miR171: 4e-28
UniProt no hits

RFAM MIR171_1: 1e-46

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record

references

[1] Bonnet E, Unpublished (2007).,




Liczniki na strone;