miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST040709
species: Medicago truncatula
miRNA family: MIR395
source: miRBase, original name: mtr-MIR395b (MI0001747)

Taxonomy by NCBI:
Medicago truncatula Medicago Trifolieae Papilionoideae Fabaceae Fabales fabids rosids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
ATGAAGTATTTGGGGGAACTC

miRNA*
GTTCCTCTGAATGCTTCAAAC

mismatches: 3
bulges: 0

View larger
pre-miRNA
TACTTGTTGATTTTCTCTTGGAGTTCCTCTGAATGCTTCAAACATGAGACAATCTTGATAGAAATTATGGATAGTTCTTGTTCAATGAAGTATTTGGGGG
AACTC
TTGGAATTGAATCAACATA


dot-bracket secondary structure
....(((((((((..(((.((((((((((..(((((((((((((.(((.(.((((((((....)))).)))).)))).))))...)))))))))..))))
)))))
).)))...)))))))))..



SIMILARITIES
miRBase mtr-MIR395j: 5e-19

PMRD mtr-miR395b: 3e-66

microPC no hits
UniProt no hits

RFAM mir-395: 1e-53

Identical with: mtr-miR395b from PMRD (MNEST048733)

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record

references

[1] Dezulian T, Palatnik JF, Huson DH, Weigel D, http://genomebiology.com/2005/6/11/p13 (2005)., "Conservation and divergence of microRNA families in plants"




Liczniki na strone;