miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST040714
species: Medicago truncatula
miRNA family: MIR395
source: miRBase, original name: mtr-MIR395g (MI0005074)

Taxonomy by NCBI:
Medicago truncatula Medicago Trifolieae Papilionoideae Fabaceae Fabales fabids rosids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TTGAAGTGTTTGGGGGAACTC

miRNA*
GTTCCTCTGAACGCTTCATAT

mismatches: 3
bulges: 0

View larger
pre-miRNA
GAGTTCCTCTGAACGCTTCATATAAGAGGTTATCCATCTTCATTGAAGTGTTTGGGGGAACTC

dot-bracket secondary structure
(((((((((..(((((((((...((((((....)).))))...)))))))))..)))))))))


SIMILARITIES
miRBase mtr-MIR395h: 0.0000002

PMRD mtr-miR395g: 4e-30

microPC miR395: 0.00004
UniProt no hits

RFAM mir-395: 6e-29

Identical with: mtr-miR395g from PMRD (MNEST048738)

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record

references

[1] Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L, Cell Res. 15:631-638(2005)., "Molecular evolution of the rice miR395 gene family"




Liczniki na strone;