ABOUT THIS RECORDspecies: Vitis vinifera
miRNA family: MIR166
source: miRBase, original name: vvi-MIR166g (MI0006513)
Taxonomy by NCBI:
Vitis vinifera Vitis Vitaceae Vitales rosids incertae sedis rosids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA TCGGACCAGGCTTCATTCCCC miRNA* GGAATGTTGTCTGGTTCGAGA mismatches: 2 bulges: 0 |
pre-miRNA
AACAGTTGAGGGGAATGTTGTCTGGTTCGAGATCCTTCGTATGAAGCTCAAGCAGCGTTTGAATGATTTCGGACCAGGCTTCATTCCCCTCAACCCAAAA
dot-bracket secondary structure
....(((((((((((((..(((((((((((((((.((((.(((..((....))..))).)))).)))))))))))))))..)))))))))))))......
SIMILARITIES
MORE
miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
degradome data
download this record
evidence: Array, Solexa
deep sequencing data evidence
references
[1] Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro, Nature. 449:463-467(2007)., "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla"
[2] Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS, BMC Genomics. 10:558(2009)., "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera"
AACAGTTGAGGGGAATGTTGTCTGGTTCGAGATCCTTCGTATGAAGCTCAAGCAGCGTTTGAATGATTTCGGACCAGGCTTCATTCCCCTCAACCCAAAA
dot-bracket secondary structure
....(((((((((((((..(((((((((((((((.((((.(((..((....))..))).)))).)))))))))))))))..)))))))))))))......
SIMILARITIES| miRBase tcc-MIR166a: 0.000000000000005 PMRD vvi-miR166g: 5e-52 microPC miR166: 0.000005 | UniProt no hits RFAM mir-166: 9e-45 |
Identical with: vvi-miR166g from PMRD (MNEST054795) |
MOREmiRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
degradome data
download this record
evidence: Array, Solexa
deep sequencing data evidence
references
[1] Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro, Nature. 449:463-467(2007)., "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla"
[2] Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS, BMC Genomics. 10:558(2009)., "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera"
