miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST045253
species: Helianthus tuberosus
source: microPC, original name: miR171

Taxonomy by NCBI:
Helianthus tuberosus Helianthus Heliantheae Heliantheae alliance Asteroideae Asteraceae Asterales campanulids asterids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TGAGCCGTGCCAATATCACG

miRNA*
AGATGTTGGTTCGGTTCAAT

mismatches: 2
bulges: 0

View larger
pre-miRNA
CGAGATGTTGGTTCGGTTCAATAAGAACTCAACGTTCAAATGGTGCATTGAACGTTGCTTTTTGATTGAGCCGTGCCAATATCACG

dot-bracket secondary structure
((.(((((((((.(((((((((.((((..((((((((((........))))))))))..)))).))))))))).))))))))).))


SIMILARITIES
miRBase rco-MIR171a: 0.00000000007

PMRD vvi-miR171c: 0.000000004

microPC miR171: 1e-43
UniProt no hits

RFAM MIR171_1: 0.000000001

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
download this record





Liczniki na strone;