miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST046319
species: Papaver somniferum
source: microPC, original name: miR1533

Taxonomy by NCBI:
Papaver somniferum Papaver Papaveraceae Ranunculales stem eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TAATAAAATTAATAATG

miRNA*
TTATTAGTTTATATAAAT

mismatches: 3
bulges: 1

View larger
pre-miRNA
TTATTAGTTTATATAAATAAAATCATTAGTAGGACCCAACTCTTATTAGTTTATGTTAATAAAATTAATAATG

dot-bracket secondary structure
((((((((((.(((.((((.((..((((((((((......)))))))))))).)))).)))))))))))))..


SIMILARITIES
miRBase no hits

PMRD no hits

microPC no hits
UniProt no hits

RFAM no hits

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: not a miRNA
download this record





Liczniki na strone;