miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST052653
species: Populus trichocarpa
source: PMRD, original name: ptc-miRf10831-akr

Taxonomy by NCBI:
Populus trichocarpa Populus Saliceae Salicaceae Malpighiales fabids rosids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
CCATAGCCACAGCATGCCAT

miRNA*
TGCATGCTTGGGCTGTGGCA

mismatches: 3
bulges: 0

View larger
pre-miRNA
CTATCATTGCATGCTTGGGCTGTGGCACTGGTTCCATCCAAAACTTTTGTTTGCCCACAGACAATCCTTCTGTCATAGTTCAGAGGTGGTCCTCCATAGC
CACAGCATGCCAT
TATGG


dot-bracket secondary structure
((((.((.(((((((..((((((((....((..(((((........(((((((....)))))))....((((........))))))))).)).)))))))
)..))))))).))
.))))



SIMILARITIES
miRBase no hits

PMRD no hits

microPC no hits
UniProt sp|Q3ECP6|GDL22_ARATH: 0.000000000003

RFAM no hits

MORE

miRNEST target predictions
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record





Liczniki na strone;