miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Back to search results



ABOUT THIS RECORD

ID: MNEST054664
species: Solanum tuberosum
source: PMRD, original name: stu-miR158

Taxonomy by NCBI:
Solanum tuberosum Solanum Solaneae Solanoideae Solanaceae Solanales lamiids asterids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TCCCAAATGTATACAAAGGA

miRNA*
CTCCGTCTTACTTGAGAAT

mismatches: 6
bulges: 3

View larger
pre-miRNA
CCTCCGTCTTACTTGAGAATATCCCAAATGTATACAAAGGA

dot-bracket secondary structure
(((..((..((((((.(.....).)))..))).))..))).


SIMILARITIES
miRBase no hits

PMRD ppt-miR158: 0.0004

microPC no hits
UniProt no hits

RFAM no hits

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: not a miRNA
download this record





Liczniki na strone;