miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Nematostella vectensis, Anemonia viridis, Metridium senile, Aiptasia pallida



ABOUT THIS RECORD

ID: MNEST008536
species: Nematostella vectensis
miRNA family: miR-2049
source: miRNEST

Taxonomy by NCBI:
Nematostella vectensis Nematostella Edwardsiidae Actiniaria Hexacorallia Anthozoa Cnidaria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
GATTCATTTGCATGCATTTGC

miRNA*
AGATGCGTGCAAATGAAGATG

mismatches: 2
bulges: 0

View larger
pre-miRNA
ATTACTAAGGCTAAGTTCAGACGTTGTATTGTCCACGGGCCGTGTTCGGTGCAGATGCGTGCAAATGAAGATGATACAATCGACTAGATTCATTTGCATG
CATTTGC
ATTGAGTGCGGCTGGTGAATAGTACGACGTTGGAACTTAGCCTAAGAAA


dot-bracket secondary structure
....((.(((((((((((.(((((((((((((.(((.((((((((((((((((((((((((((((((((..((((...))))......))))))))))))
)))))))
))))))))))))).))).))))))))))))).))))))))))).))...



SIMILARITIES
miRBase nve-mir-2049: 0.0000000000001

PMRD no hits

microPC no hits
UniProt no hits

RFAM no hits
most similar mature miRNAs

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
download this record





Liczniki na strone;