miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Bombus terrestris, Solenopsis invicta, Apis mellifera



ABOUT THIS RECORD

ID: MNEST035392
species: Apis mellifera
miRNA family: mir-315
source: miRBase, original name: ame-mir-315 (MI0001592)

Taxonomy by NCBI:
Apis mellifera Apis Apini Apinae Apidae Apoidea Aculeata Apocrita Hymenoptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TTTTGATTGTTGCTCAGAAAGC

miRNA*
TTTCGGGCAATAATCATAATC

mismatches: 1
bulges: 1

View larger
pre-miRNA
GCTCTTTATGCTTTTGATTGTTGCTCAGAAAGCCTTGATTATGATATTGGCTTTCGGGCAATAATCATAATCACGAAAGGGT

dot-bracket secondary structure
(((((((.((.((.((((((((((((.(((((((..............))))))))))))))))))).)).))..)))))))


SIMILARITIES
miRBase nlo-mir-315: 7e-23

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-315: 2e-39

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record





Liczniki na strone;