miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Mus musculus, Sus scrofa, Bos taurus, Rattus norvegicus, Gallus gallus, Canis lupus familiaris, Ovis aries, Macaca fascicularis, Anolis carolinensis, Trichosurus vulpecula, Papio anubis, Homo sapiens, Taeniopygia guttata, Peromyscus maniculatus bairdii, Pongo abelii, Ursus americanus, Equus caballus, Oryctolagus cuniculus, Macaca nemestrina, Cavia porcellus, Bos indicus, Meleagris gallopavo, Lonchura striata domestica, Bos sp., Macropus eugenii, Peromyscus polionotus subgriseus, Capra hircus, Pan troglodytes verus, Macaca mulatta



ABOUT THIS RECORD

ID: MNEST032217
species: Mus musculus
miRNA family: mir-582
source: miRBase, original name: mmu-mir-582 (MI0006127)

Taxonomy by NCBI:
Mus musculus Mus Mus Murinae Muridae Muroidea Sciurognathi Rodentia Glires Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TACAGTTGTTCAACCAGTTACT

miRNA*
TAACCTGTTGAACAACTGAACC

mismatches: 5
bulges: 0

View larger
pre-miRNA
ACTCTTTGGATACAGTTGTTCAACCAGTTACTAATCTAACTAATTGTAACCTGTTGAACAACTGAACCCAAAGGGTGCAAA

dot-bracket secondary structure
(((((((((...((((((((((((..(((((..............)))))..))))))))))))...))))))))).....


SIMILARITIES
miRBase mmu-mir-582: 9e-41

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-582: 2e-39

MORE

miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Solexa

references

[1] Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
[2] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3] Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"




Liczniki na strone;