miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Mus musculus, Sus scrofa, Bos taurus, Rattus norvegicus, Gallus gallus, Canis lupus familiaris, Ovis aries, Macaca fascicularis, Anolis carolinensis, Trichosurus vulpecula, Papio anubis, Homo sapiens, Taeniopygia guttata, Peromyscus maniculatus bairdii, Pongo abelii, Ursus americanus, Equus caballus, Oryctolagus cuniculus, Macaca nemestrina, Cavia porcellus, Bos indicus, Meleagris gallopavo, Lonchura striata domestica, Bos sp., Macropus eugenii, Peromyscus polionotus subgriseus, Capra hircus, Pan troglodytes verus, Macaca mulatta



ABOUT THIS RECORD

ID: MNEST004986
species: Mus musculus
miRNA family: mir-1195
source: miRNEST

Taxonomy by NCBI:
Mus musculus Mus Mus Murinae Muridae Muroidea Sciurognathi Rodentia Glires Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TGAGTTCGAGGCCAGCCTGGT

miRNA*
CAGGACAGCCAGGGCTACAGA

mismatches: 4
bulges: 2

View larger
pre-miRNA
AGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTGCCAGGACAGCCAGGGCTACAGAGAGAAACCCTGTCTCCAA

dot-bracket secondary structure
.....((((((((....(((((((((((..(((...((((((((........)).))))))...))).))))).)))))).....))))))))...


SIMILARITIES
miRBase mmu-mir-3470b: 4e-25

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-1937: 0.00000002
most similar mature miRNAs

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
download this record





Liczniki na strone;