miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Bicyclus anynana, Drosophila melanogaster, Bombyx mori, Aedes aegypti, Ixodes scapularis, Litopenaeus vannamei, Lepeophtheirus salmonis, Acyrthosiphon pisum, Culex quinquefasciatus, Anopheles gambiae, Dendroctonus ponderosae, Daphnia pulex, Nasonia vitripennis, Drosophila simulans, Petrolisthes cinctipes, Aphis gossypii, Tetranychus urticae, Glossina morsitans morsitans, Choristoneura fumiferana, Spodoptera frugiperda, Heliothis virescens, Rhipicephalus microplus, Locusta migratoria, Phlebotomus papatasi, Penaeus monodon, Drosophila sechellia, Drosophila auraria, Artemia franciscana, Nilaparvata lugens, Antheraea assama, Drosophila pseudoobscura, Teleopsis dalmanni, Lutzomyia longipalpis, Caligus rogercresseyi, Nasonia giraulti, Homarus americanus, Bombus terrestris, Myzus persicae, Drosophila willistoni, Drosophila ananassae, Solenopsis invicta, Drosophila virilis, Drosophila erecta, Drosophila grimshawi, Ceratitis capitata, Spodoptera littoralis, Peregrinus maidis, Samia cynthia ricini, Drosophila mojavensis, Danaus plexippus, Rhipicephalus appendiculatus, Cochliomyia hominivorax, Anopheles stephensi, Diabrotica virgifera virgifera, Haematobia irritans irritans, Eriocheir sinensis, Papilio xuthus, Onychiurus arcticus, Rhodnius prolixus, Carcinus maenas, Polypedilum vanderplanki, Ostrinia nubilalis, Lernaeocera branchialis, Caligus clemensi, Laupala kohalensis, Frankliniella occidentalis, Daphnia magna, Gammarus pulex, Trichoplusia ni, Calanus finmarchicus, Gryllus bimaculatus, Drosophila yakuba, Epiphyas postvittana, Callinectes sapidus, Fenneropenaeus chinensis, Apis mellifera, Tribolium castaneum



ABOUT THIS RECORD

ID: MNEST008794
species: Petrolisthes cinctipes
miRNA family: mir-467
source: miRNEST

Taxonomy by NCBI:
Petrolisthes cinctipes Petrolisthes Porcellanidae Galatheoidea Anomura Pleocyemata Decapoda Eucarida Eumalacostraca Malacostraca Crustacea Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
ATATATACACACACACATGCT

miRNA*
CAGGTGAGTTGTGTAAATGTGT

mismatches: 4
bulges: 1

View larger
pre-miRNA
GTGTGCAGGTGAGTTGTGTAAATGTGTAAATTCTGGAAAAAAAACGCTTAAATGATGACGCAAATAATTATGAACGAAAGAGTTAAGGCTGATCAAGTAG
CCGAACAAAATACAGATTAACGAAATTCCGGCATATATATACACACACACATGCTTAACAAATA


dot-bracket secondary structure
((..(((.(((.((.(((((.((((((.....((((((......(((((..(((((..........)))))......))).(((..(((((......)))
)).)))..(((....)))..))...)))))).)))))).))))))).))).)))...)).....



SIMILARITIES
miRBase gga-mir-466: 0.0005

PMRD no hits

microPC no hits
UniProt no hits

RFAM no hits
most similar mature miRNAs

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: not a miRNA
Source sequences
download this record





Liczniki na strone;