miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Agrostis stolonifera, Oryza sativa, Avena barbata, Avena sativa, Festuca arundinacea, Festuca pratensis, Hordeum vulgare, Hordeum vulgare subsp. spontaneum, Leymus cinereus x Leymus triticoides, Lolium perenne, Pseudoroegneria spicata, Triticum monococcum, Triticum turgidum subsp. durum, Brachypodium distachyon, Triticum aestivum



ABOUT THIS RECORD

ID: MNEST000942
species: Hordeum vulgare
miRNA family: MIRf341
source: miRNEST

Taxonomy by NCBI:
Hordeum vulgare Hordeum Triticeae Pooideae BEP clade Poaceae Poales commelinids Liliopsida Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TATATACTCCCTCCGTCCGGA

miRNA*
CGGACGCAGGGAGTATTATATA

mismatches: 1
bulges: 1

View larger
pre-miRNA
GCATGTGCTAATATATACTCCCTCCGTCCGGAAATACTTGTTCTAGAAAATCATGTATTTAGACTTATTTTAGTTATAGATACATTCATTTTATTCATTT
CTAGGACAAGTATTTTCGGACGCAGGGAGTATTATATATGATCCA


dot-bracket secondary structure
((....))..(((((((((((((.(((((((((((((((((((((((((...(((((((((((((......)))).)))))))))............)))
)))))))))))))))))))))).)))))))).)))))........



SIMILARITIES
miRBase tae-MIR1128: 0.000000007

PMRD tae-miR1128: 0.00000000003

microPC miR1133: 2e-27
UniProt no hits

RFAM MIR1122: 3e-30
most similar mature miRNAs

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
degradome data
download this record





Liczniki na strone;