miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Bicyclus anynana, Mus musculus, Sus scrofa, Bos taurus, Danio rerio, Ciona intestinalis, Rattus norvegicus, Drosophila melanogaster, Xenopus laevis, Oryzias latipes, Gallus gallus, Salmo salar, Canis lupus familiaris, Ictalurus punctatus, Ovis aries, Branchiostoma floridae, Bombyx mori, Aedes aegypti, Oncorhynchus mykiss, Gasterosteus aculeatus, Pimephales promelas, Aplysia californica, Lottia gigantea, Gadus morhua, Alvinella pompejana, Ixodes scapularis, Macaca fascicularis, Litopenaeus vannamei, Anolis carolinensis, Trichosurus vulpecula, Papio anubis, Paracentrotus lividus, Ictalurus furcatus, Lepeophtheirus salmonis, Homo sapiens, Acyrthosiphon pisum, Culex quinquefasciatus, Saccoglossus kowalevskii, Anopheles gambiae, Dendroctonus ponderosae, Daphnia pulex, Nasonia vitripennis, Strongylocentrotus purpuratus, Petromyzon marinus, Drosophila simulans, Oreochromis niloticus, Molgula tectiformis, Helobdella robusta, Petrolisthes cinctipes, Taeniopygia guttata, Aphis gossypii, Ciona savignyi, Tetranychus urticae, Glossina morsitans morsitans, Peromyscus maniculatus bairdii, Fundulus heteroclitus, Choristoneura fumiferana, Sparus aurata, Spodoptera frugiperda, Halocynthia roretzi, Heliothis virescens, Crassostrea gigas, Patiria pectinifera, Dicentrarchus labrax, Biomphalaria glabrata, Rhipicephalus microplus, Pongo abelii, Locusta migratoria, Phlebotomus papatasi, Mytilus californianus, Penaeus monodon, Ursus americanus, Drosophila sechellia, Drosophila auraria, Artemia franciscana, Nilaparvata lugens, Equus caballus, Dissostichus mawsoni, Osmerus mordax, Euprymna scolopes, Antheraea assama, Drosophila pseudoobscura, Oryctolagus cuniculus, Macaca nemestrina, Anoplopoma fimbria, Cyprinus carpio, Teleopsis dalmanni, Lutzomyia longipalpis, Esox lucius, Squalus acanthias, Caligus rogercresseyi, Leucoraja erinacea, Nasonia giraulti, Homarus americanus, Bombus terrestris, Rana catesbeiana, Myzus persicae, Drosophila willistoni, Takifugu rubripes, Cynops pyrrhogaster, Eptatretus burgeri, Sebastes caurinus, Drosophila ananassae, Solenopsis invicta, Drosophila virilis, Drosophila erecta, Misgurnus anguillicaudatus, Perca flavescens, Paralabidochromis chilotes, Drosophila grimshawi, Ceratitis capitata, Hippoglossus hippoglossus, Spodoptera littoralis, Peregrinus maidis, Ambystoma tigrinum tigrinum, Samia cynthia ricini, Lumbricus rubellus, Cavia porcellus, Drosophila mojavensis, Danaus plexippus, Bos indicus, Rhipicephalus appendiculatus, Cochliomyia hominivorax, Rutilus rutilus, Anopheles stephensi, Diabrotica virgifera virgifera, Meleagris gallopavo, Tubifex tubifex, Haematobia irritans irritans, Eriocheir sinensis, Papilio xuthus, Onychiurus arcticus, Lonchura striata domestica, Poecilia reticulata, Rhodnius prolixus, Carcinus maenas, Bos sp., Polypedilum vanderplanki, Ostrinia nubilalis, Lernaeocera branchialis, Macropus eugenii, Caligus clemensi, Peromyscus polionotus subgriseus, Laupala kohalensis, Oncorhynchus tshawytscha, Frankliniella occidentalis, Capra hircus, Daphnia magna, Paralichthys olivaceus, Psetta maxima, Gammarus pulex, Trichoplusia ni, Pan troglodytes verus, Spadella cephaloptera, Lymnaea stagnalis, Lates calcarifer, Calanus finmarchicus, Oncorhynchus nerka, Gryllus bimaculatus, Sebastes rastrelliger, Drosophila yakuba, Thymallus thymallus, Solea senegalensis, Epiphyas postvittana, Callinectes sapidus, Peripatopsis sedgwicki, Fenneropenaeus chinensis, Coregonus clupeaformis, Torpedo californica, Thunnus thynnus, Cynoglossus semilaevis, Salvelinus fontinalis, Apis mellifera, Tribolium castaneum, Macaca mulatta



ABOUT THIS RECORD

ID: MNEST009440
species: Nasonia giraulti
miRNA family: mir-595
source: miRNEST

Taxonomy by NCBI:
Nasonia giraulti Nasonia Pteromalinae Pteromalidae Chalcidoidea Chaldicoidea group Apocrita Hymenoptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
AAAGTGTGCTGTGGTTTGTCG

miRNA*
ACAAACCAGAGTTTAAGTTTCT

mismatches: 3
bulges: 1

View larger
pre-miRNA
GTGATGTTACTGACAAACCAGAGTTTAAGTTTCTGCCTCATAATATCATGTACAAAGTGTGCTGTGGTTTGTCGAGAAAGGAC

dot-bracket secondary structure
..........((((((((((.(((.((..(((.(((.............))).))).)).))).)))))))))).........


SIMILARITIES
miRBase no hits

PMRD no hits

microPC no hits
UniProt no hits

RFAM no hits
most similar mature miRNAs

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: not a miRNA
Source sequences
download this record





Liczniki na strone;