miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Litopenaeus vannamei, Lepeophtheirus salmonis, Daphnia pulex, Petrolisthes cinctipes, Penaeus monodon, Artemia franciscana, Caligus rogercresseyi, Homarus americanus, Eriocheir sinensis, Carcinus maenas, Lernaeocera branchialis, Caligus clemensi, Daphnia magna, Gammarus pulex, Calanus finmarchicus, Callinectes sapidus, Fenneropenaeus chinensis



ABOUT THIS RECORD

ID: MNEST008789
species: Petrolisthes cinctipes
miRNA family: miR-1412
source: miRNEST

Taxonomy by NCBI:
Petrolisthes cinctipes Petrolisthes Porcellanidae Galatheoidea Anomura Pleocyemata Decapoda Eucarida Eumalacostraca Malacostraca Crustacea Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TGGGTGAGGAGAGCGAGGAGG

miRNA*
TCCATGATCTTCTCAATCATC

mismatches: 4
bulges: 0

View larger
pre-miRNA
GAGTGTGGCGATGGGTGAGGAGAGCGAGGAGGACTGTGACTATTCCACTGTACTACCGAGGGTGAAGCAAGAGCCCCTCTCACTCCATGATCTTCTCAAT
CATC
TTGTCACT


dot-bracket secondary structure
....((((((((((.((((((((.((.((((.((.(((.......))).))......(((((....((....)))))))...)))).)).)))))))).)
))))
..))))).



SIMILARITIES
miRBase no hits

PMRD no hits

microPC no hits
UniProt no hits

RFAM no hits
most similar mature miRNAs

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: not a miRNA
Source sequences
download this record





Liczniki na strone;