miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Pleurobrachia pileus, Mnemiopsis leidyi



ABOUT THIS RECORD

ID: MNEST009316
species: Pleurobrachia pileus
miRNA family: miR-1814c
source: miRNEST

Taxonomy by NCBI:
Pleurobrachia pileus Pleurobrachia Pleurobrachiidae Cydippida Typhlocoela Ctenophora Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
GTTTTGTTGGGGTTTGTTCCA

miRNA*
GAGCAAACCTCCACAAAACAT

mismatches: 3
bulges: 0

View larger
pre-miRNA
ATTGAACCGAAGAGCAAACCTCCACAAAACATTAACGATTAAAATTAAAACCATCTGTTCAGCATAGTACTAATCGATTAAAGAAGTTTTGTTGGGGTTT
GTTCCA
ATTCCTAC


dot-bracket secondary structure
...........(((((((((((.(((((((.((((((((((..((((.................))))..)))))).))))....))))))).)))))))
))))..
........



SIMILARITIES
miRBase no hits

PMRD no hits

microPC no hits
UniProt no hits

RFAM no hits
most similar mature miRNAs

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
download this record





Liczniki na strone;