miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Mus musculus, Sus scrofa, Bos taurus, Danio rerio, Ciona intestinalis, Rattus norvegicus, Xenopus laevis, Oryzias latipes, Gallus gallus, Salmo salar, Canis lupus familiaris, Ictalurus punctatus, Ovis aries, Branchiostoma floridae, Oncorhynchus mykiss, Gasterosteus aculeatus, Pimephales promelas, Gadus morhua, Macaca fascicularis, Anolis carolinensis, Trichosurus vulpecula, Papio anubis, Paracentrotus lividus, Ictalurus furcatus, Homo sapiens, Saccoglossus kowalevskii, Strongylocentrotus purpuratus, Petromyzon marinus, Oreochromis niloticus, Molgula tectiformis, Taeniopygia guttata, Ciona savignyi, Peromyscus maniculatus bairdii, Fundulus heteroclitus, Sparus aurata, Halocynthia roretzi, Patiria pectinifera, Dicentrarchus labrax, Pongo abelii, Ursus americanus, Equus caballus, Dissostichus mawsoni, Osmerus mordax, Oryctolagus cuniculus, Macaca nemestrina, Anoplopoma fimbria, Cyprinus carpio, Esox lucius, Squalus acanthias, Leucoraja erinacea, Rana catesbeiana, Takifugu rubripes, Cynops pyrrhogaster, Eptatretus burgeri, Sebastes caurinus, Misgurnus anguillicaudatus, Perca flavescens, Paralabidochromis chilotes, Hippoglossus hippoglossus, Ambystoma tigrinum tigrinum, Cavia porcellus, Bos indicus, Rutilus rutilus, Meleagris gallopavo, Lonchura striata domestica, Poecilia reticulata, Bos sp., Macropus eugenii, Peromyscus polionotus subgriseus, Oncorhynchus tshawytscha, Capra hircus, Paralichthys olivaceus, Psetta maxima, Pan troglodytes verus, Spadella cephaloptera, Lates calcarifer, Oncorhynchus nerka, Sebastes rastrelliger, Thymallus thymallus, Solea senegalensis, Coregonus clupeaformis, Torpedo californica, Thunnus thynnus, Cynoglossus semilaevis, Salvelinus fontinalis, Macaca mulatta



ABOUT THIS RECORD

ID: MNEST004969
species: Mus musculus
miRNA family: mir-1227
source: miRNEST

Taxonomy by NCBI:
Mus musculus Mus Mus Murinae Muridae Muroidea Sciurognathi Rodentia Glires Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
GATGGGCCAGGCGGTGGTGGC

miRNA*
CAAGCCAGCCTGGTCTACAGA

mismatches: 4
bulges: 2

View larger
pre-miRNA
TAAGGAAGCAAGATGGGCCAGGCGGTGGTGGCGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGACGGATTTCTGAGTTCCAAGCCAGCCTGGT
CTACAGA
GTGAGTTC


dot-bracket secondary structure
...(((..((...(((((((((((((..(((.((..((((((..(((((.....)))))...))))))...(((....))).)).))).))).)))))))
)))....
.))..)))



SIMILARITIES
miRBase mmu-mir-3470b: 7e-21

PMRD ptc-miRf12412-akr: 0.00009

microPC no hits
UniProt no hits

RFAM Metazoa_SRP: 0.000000002
most similar mature miRNAs

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
download this record





Liczniki na strone;