miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Bicyclus anynana, Drosophila melanogaster, Bombyx mori, Aedes aegypti, Culex quinquefasciatus, Anopheles gambiae, Dendroctonus ponderosae, Nasonia vitripennis, Drosophila simulans, Glossina morsitans morsitans, Choristoneura fumiferana, Spodoptera frugiperda, Heliothis virescens, Phlebotomus papatasi, Drosophila sechellia, Drosophila auraria, Antheraea assama, Drosophila pseudoobscura, Teleopsis dalmanni, Lutzomyia longipalpis, Nasonia giraulti, Bombus terrestris, Drosophila willistoni, Drosophila ananassae, Solenopsis invicta, Drosophila virilis, Drosophila erecta, Drosophila grimshawi, Ceratitis capitata, Spodoptera littoralis, Samia cynthia ricini, Drosophila mojavensis, Danaus plexippus, Cochliomyia hominivorax, Anopheles stephensi, Diabrotica virgifera virgifera, Haematobia irritans irritans, Papilio xuthus, Polypedilum vanderplanki, Ostrinia nubilalis, Trichoplusia ni, Drosophila yakuba, Epiphyas postvittana, Apis mellifera, Tribolium castaneum



ABOUT THIS RECORD

ID: MNEST007163
species: Bombyx mori
miRNA family: mir-2807
source: miRNEST

Taxonomy by NCBI:
Bombyx mori Bombyx Bombycinae Bombycidae Bombyciformes Bombycoidea Obtectomera Ditrysia Heteroneura Neolepidoptera Glossata Lepidoptera Amphiesmenoptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
CAACTGCATACAAAATTGGGT

miRNA*
TCATATTTGTATGGAATGGG

mismatches: 5
bulges: 1

View larger
pre-miRNA
TGAATGTACAATGTGCTTAGTGCGAGTTTTTTAACGCTCTCGATAGCGCAAAAGTTTAAAGCTCATATTTGTATGGAATGGGATCGTTTGCCTACGTTTG
CCGCTAGGGGCGCTGTTTCAACTGCATACAAAATTGGGTTAACTTTTACGCTATCGAGAACGTTAGAAGACTCGCACTAAGCACACAAAAAACGAACG


dot-bracket secondary structure
...........(((((((((((((((((((((((((.(((((((((((.(((((((...((((((..((((((((...((((((.((..((((..((...
..))...)))))).))))))....))))))))..))))))))))))).))))))))))).))))))))))))))))))))))))).............



SIMILARITIES
miRBase bmo-mir-2807d: 1e-26

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-2807: 1e-39
most similar mature miRNAs

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
download this record





Liczniki na strone;