miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Bicyclus anynana, Drosophila melanogaster, Bombyx mori, Aedes aegypti, Culex quinquefasciatus, Anopheles gambiae, Dendroctonus ponderosae, Nasonia vitripennis, Drosophila simulans, Glossina morsitans morsitans, Choristoneura fumiferana, Spodoptera frugiperda, Heliothis virescens, Phlebotomus papatasi, Drosophila sechellia, Drosophila auraria, Antheraea assama, Drosophila pseudoobscura, Teleopsis dalmanni, Lutzomyia longipalpis, Nasonia giraulti, Bombus terrestris, Drosophila willistoni, Drosophila ananassae, Solenopsis invicta, Drosophila virilis, Drosophila erecta, Drosophila grimshawi, Ceratitis capitata, Spodoptera littoralis, Samia cynthia ricini, Drosophila mojavensis, Danaus plexippus, Cochliomyia hominivorax, Anopheles stephensi, Diabrotica virgifera virgifera, Haematobia irritans irritans, Papilio xuthus, Polypedilum vanderplanki, Ostrinia nubilalis, Trichoplusia ni, Drosophila yakuba, Epiphyas postvittana, Apis mellifera, Tribolium castaneum



ABOUT THIS RECORD

ID: MNEST037578
species: Nasonia giraulti
miRNA family: mir-99
source: miRBase, original name: ngi-mir-100 (MI0016643)

Taxonomy by NCBI:
Nasonia giraulti Nasonia Pteromalinae Pteromalidae Chalcidoidea Chaldicoidea group Apocrita Hymenoptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TACCCGTAGATCCGACTGTGGG

miRNA*
TACGCAAGCTCCTATCTACCGGTACA

mismatches: 4
bulges: 2

View larger
pre-miRNA
TACTGATGACACTACCCGTAGATCCGACTGTGGGCTTTTATATGCATACGCAAGCTCCTATCTACCGGTACATGTAGTCAGGCC

dot-bracket secondary structure
..(((((.(((.((((.((((((..(((((((.((........))...))).)).))..)))))).))))..))).)))))...


SIMILARITIES
miRBase nvi-mir-100: 3e-19

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-10: 0.0000000003

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record

references

[1] Sathyamurthy G, Swamy NR, Int J Insect Sci. 2:1-13(2010)., "Computational Identification and Characterization of Putative miRNAs in Nasonia Species"




Liczniki na strone;