miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Mus musculus, Rattus norvegicus, Macaca fascicularis, Papio anubis, Homo sapiens, Peromyscus maniculatus bairdii, Pongo abelii, Oryctolagus cuniculus, Macaca nemestrina, Cavia porcellus, Peromyscus polionotus subgriseus, Pan troglodytes verus, Macaca mulatta



ABOUT THIS RECORD

ID: MNEST032453
species: Mus musculus
miRNA family: mir-1949
source: miRBase, original name: mmu-mir-1949 (MI0009940)

Taxonomy by NCBI:
Mus musculus Mus Mus Murinae Muridae Muroidea Sciurognathi Rodentia Glires Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
CTATACCAGGATGTCAGCATAGTT

miRNA*
CTGGTTGGCATTCTGGGCCTGGTT

mismatches: 3
bulges: 2

View larger
pre-miRNA
GCTGGTTGGCATTCTGGGCCTGGTTCATGCCACCTCTGTTGTTAACTATACCAGGATGTCAGCATAGTTG

dot-bracket secondary structure
(((((((((((((((((...(((((.((..((....))..)).)))))..))))))))))))).))))..


SIMILARITIES
miRBase rno-mir-1949: 7e-32

PMRD no hits

microPC no hits
UniProt no hits

RFAM SNORA74: 3e-28

MORE

miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: Solexa

references

[1] Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model"




Liczniki na strone;