miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Bicyclus anynana, Acropora millepora, Mus musculus, Sus scrofa, Bos taurus, Danio rerio, Ciona intestinalis, Rattus norvegicus, Drosophila melanogaster, Xenopus laevis, Oryzias latipes, Gallus gallus, Salmo salar, Caenorhabditis elegans, Canis lupus familiaris, Ictalurus punctatus, Ovis aries, Branchiostoma floridae, Bombyx mori, Aedes aegypti, Oncorhynchus mykiss, Gasterosteus aculeatus, Pimephales promelas, Aplysia californica, Lottia gigantea, Gadus morhua, Alvinella pompejana, Schistosoma mansoni, Ixodes scapularis, Hydra vulgaris, Macaca fascicularis, Litopenaeus vannamei, Anolis carolinensis, Trichosurus vulpecula, Papio anubis, Paracentrotus lividus, Ictalurus furcatus, Lepeophtheirus salmonis, Homo sapiens, Acyrthosiphon pisum, Culex quinquefasciatus, Saccoglossus kowalevskii, Nematostella vectensis, Anopheles gambiae, Dendroctonus ponderosae, Daphnia pulex, Nasonia vitripennis, Strongylocentrotus purpuratus, Petromyzon marinus, Drosophila simulans, Oreochromis niloticus, Molgula tectiformis, Schistosoma japonicum, Helobdella robusta, Petrolisthes cinctipes, Taeniopygia guttata, Aphis gossypii, Clytia hemisphaerica, Ciona savignyi, Ancylostoma caninum, Tetranychus urticae, Glossina morsitans morsitans, Peromyscus maniculatus bairdii, Fundulus heteroclitus, Choristoneura fumiferana, Sparus aurata, Spodoptera frugiperda, Halocynthia roretzi, Heliothis virescens, Crassostrea gigas, Patiria pectinifera, Ascaris suum, Dicentrarchus labrax, Biomphalaria glabrata, Heterorhabditis bacteriophora, Rhipicephalus microplus, Brachionus plicatilis, Pongo abelii, Locusta migratoria, Acropora palmata, Phlebotomus papatasi, Mytilus californianus, Anemonia viridis, Penaeus monodon, Ursus americanus, Drosophila sechellia, Drosophila auraria, Artemia franciscana, Pristionchus pacificus, Nilaparvata lugens, Equus caballus, Dissostichus mawsoni, Osmerus mordax, Euprymna scolopes, Pleurobrachia pileus, Antheraea assama, Drosophila pseudoobscura, Oryctolagus cuniculus, Macaca nemestrina, Anoplopoma fimbria, Cyprinus carpio, Teleopsis dalmanni, Montastraea faveolata, Lutzomyia longipalpis, Caenorhabditis japonica, Esox lucius, Squalus acanthias, Caligus rogercresseyi, Leucoraja erinacea, Taenia solium, Nasonia giraulti, Homarus americanus, Caenorhabditis brenneri, Bombus terrestris, Metridium senile, Rana catesbeiana, Myzus persicae, Strongyloides ratti, Drosophila willistoni, Brugia malayi, Takifugu rubripes, Cynops pyrrhogaster, Trichinella spiralis, Meloidogyne hapla, Heterodera glycines, Eptatretus burgeri, Sebastes caurinus, Drosophila ananassae, Solenopsis invicta, Drosophila virilis, Drosophila erecta, Misgurnus anguillicaudatus, Perca flavescens, Paralabidochromis chilotes, Drosophila grimshawi, Ceratitis capitata, Hippoglossus hippoglossus, Spodoptera littoralis, Peregrinus maidis, Ambystoma tigrinum tigrinum, Meloidogyne incognita, Caenorhabditis remanei, Samia cynthia ricini, Lumbricus rubellus, Cavia porcellus, Drosophila mojavensis, Danaus plexippus, Bos indicus, Rhipicephalus appendiculatus, Cochliomyia hominivorax, Rutilus rutilus, Anopheles stephensi, Diabrotica virgifera virgifera, Meleagris gallopavo, Trichinella pseudospiralis, Tubifex tubifex, Haematobia irritans irritans, Eriocheir sinensis, Papilio xuthus, Onychiurus arcticus, Lonchura striata domestica, Poecilia reticulata, Mnemiopsis leidyi, Rhodnius prolixus, Carcinus maenas, Bos sp., Polypedilum vanderplanki, Onchocerca volvulus, Ostrinia nubilalis, Lernaeocera branchialis, Macropus eugenii, Caligus clemensi, Peromyscus polionotus subgriseus, Nippostrongylus brasiliensis, Laupala kohalensis, Oncorhynchus tshawytscha, Frankliniella occidentalis, Capra hircus, Daphnia magna, Paralichthys olivaceus, Psetta maxima, Gammarus pulex, Trichoplusia ni, Meloidogyne chitwoodi, Pan troglodytes verus, Spadella cephaloptera, Globodera rostochiensis, Lymnaea stagnalis, Lates calcarifer, Porites astreoides, Calanus finmarchicus, Strongyloides stercoralis, Oncorhynchus nerka, Gryllus bimaculatus, Sebastes rastrelliger, Drosophila yakuba, Thymallus thymallus, Ancylostoma ceylanicum, Solea senegalensis, Epiphyas postvittana, Callinectes sapidus, Peripatopsis sedgwicki, Fenneropenaeus chinensis, Coregonus clupeaformis, Aiptasia pallida, Torpedo californica, Thunnus thynnus, Cynoglossus semilaevis, Salvelinus fontinalis, Schmidtea mediterranea, Apis mellifera, Tribolium castaneum, Macaca mulatta



ABOUT THIS RECORD

ID: MNEST037584
species: Nasonia giraulti
miRNA family: mir-252
source: miRBase, original name: ngi-mir-252 (MI0016651)

Taxonomy by NCBI:
Nasonia giraulti Nasonia Pteromalinae Pteromalidae Chalcidoidea Chaldicoidea group Apocrita Hymenoptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
AAGTACTAGTGCCGCAGGAG

miRNA*
CCTGCTGCTCAAGTGCTTAT

mismatches: 3
bulges: 0

View larger
pre-miRNA
AATCCCGTCCTGTTCCTAAGTACTAGTGCCGCAGGAGTGACTAGACTGGGCTAGAAATTACCGCGTCTCCTGCTGCTCAAGTGCTTATCAATGG

dot-bracket secondary structure
.........(((((..((((((((.(.((.(((((((((.((((......)))).........)).))))))).)).).))))))))..)))))


SIMILARITIES
miRBase nlo-mir-252: 2e-48

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-252: 8e-45

Identical with: nlo-mir-252 from miRBase (MNEST037615)

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record

references

[1] Sathyamurthy G, Swamy NR, Int J Insect Sci. 2:1-13(2010)., "Computational Identification and Characterization of Putative miRNAs in Nasonia Species"




Liczniki na strone;