miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Oryzias latipes, Salmo salar, Oncorhynchus mykiss, Gasterosteus aculeatus, Gadus morhua, Oreochromis niloticus, Fundulus heteroclitus, Sparus aurata, Dicentrarchus labrax, Dissostichus mawsoni, Osmerus mordax, Anoplopoma fimbria, Esox lucius, Takifugu rubripes, Sebastes caurinus, Perca flavescens, Paralabidochromis chilotes, Hippoglossus hippoglossus, Poecilia reticulata, Oncorhynchus tshawytscha, Paralichthys olivaceus, Psetta maxima, Lates calcarifer, Oncorhynchus nerka, Sebastes rastrelliger, Thymallus thymallus, Solea senegalensis, Coregonus clupeaformis, Thunnus thynnus, Cynoglossus semilaevis, Salvelinus fontinalis



ABOUT THIS RECORD

ID: MNEST009417
species: Esox lucius
miRNA family: mir-467
source: miRNEST

Taxonomy by NCBI:
Esox lucius Esox Esocidae Esociformes Neognathi Euteleostei Clupeocephala Elopocephala Teleostei Neopterygii Actinopteri Actinopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
ATATACACACACACACCTACA

miRNA*
TAGCTGTGTGAGTGTGGAATAT

mismatches: 5
bulges: 1

View larger
pre-miRNA
CGCACACAGATATATACACACACACACCTACACACACACACACAGATACACATGCATACACACATACACACACACACTTGGAGTGCAGTGCCTGTGGCTG
ACTAGCTGTGTGAGTGTGGAATATTGTAACTT


dot-bracket secondary structure
........(((((.(((((.((((((.(((..((......(((((...(((.(((((.........................)))))))).)))))..))
..))).)))))).)))))..))))).......



SIMILARITIES
miRBase no hits

PMRD no hits

microPC no hits
UniProt no hits

RFAM no hits
most similar mature miRNAs

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
download this record





Liczniki na strone;