miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Mus musculus, Sus scrofa, Bos taurus, Rattus norvegicus, Canis lupus familiaris, Ovis aries, Macaca fascicularis, Papio anubis, Homo sapiens, Peromyscus maniculatus bairdii, Pongo abelii, Ursus americanus, Equus caballus, Oryctolagus cuniculus, Macaca nemestrina, Cavia porcellus, Bos indicus, Bos sp., Peromyscus polionotus subgriseus, Capra hircus, Pan troglodytes verus, Macaca mulatta



ABOUT THIS RECORD

ID: MNEST004957
species: Mus musculus
miRNA family: miR-4110
source: miRNEST

Taxonomy by NCBI:
Mus musculus Mus Mus Murinae Muridae Muroidea Sciurognathi Rodentia Glires Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
CACATGTTGTTAACAGAGTTG

miRNA*
ACCCTTTTAACCAACGTGCTTA

mismatches: 4
bulges: 1

View larger
pre-miRNA
CAAACCACTTTAACCCTTTTAACCAACGTGCTTATTCCACATGTTGTTAACAGAGTTGGCCTGGGGT

dot-bracket secondary structure
....(((..(((((.((.(((((.((((((.........))))))))))).)).)))))..)))...


SIMILARITIES
miRBase no hits

PMRD no hits

microPC no hits
UniProt no hits

RFAM no hits
most similar mature miRNAs

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
download this record





Liczniki na strone;