miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Mus musculus, Sus scrofa, Bos taurus, Danio rerio, Rattus norvegicus, Xenopus laevis, Oryzias latipes, Gallus gallus, Salmo salar, Canis lupus familiaris, Ictalurus punctatus, Ovis aries, Oncorhynchus mykiss, Gasterosteus aculeatus, Pimephales promelas, Gadus morhua, Macaca fascicularis, Anolis carolinensis, Trichosurus vulpecula, Papio anubis, Ictalurus furcatus, Homo sapiens, Oreochromis niloticus, Taeniopygia guttata, Peromyscus maniculatus bairdii, Fundulus heteroclitus, Sparus aurata, Dicentrarchus labrax, Pongo abelii, Ursus americanus, Equus caballus, Dissostichus mawsoni, Osmerus mordax, Oryctolagus cuniculus, Macaca nemestrina, Anoplopoma fimbria, Cyprinus carpio, Esox lucius, Squalus acanthias, Leucoraja erinacea, Rana catesbeiana, Takifugu rubripes, Cynops pyrrhogaster, Sebastes caurinus, Misgurnus anguillicaudatus, Perca flavescens, Paralabidochromis chilotes, Hippoglossus hippoglossus, Ambystoma tigrinum tigrinum, Cavia porcellus, Bos indicus, Rutilus rutilus, Meleagris gallopavo, Lonchura striata domestica, Poecilia reticulata, Bos sp., Macropus eugenii, Peromyscus polionotus subgriseus, Oncorhynchus tshawytscha, Capra hircus, Paralichthys olivaceus, Psetta maxima, Pan troglodytes verus, Lates calcarifer, Oncorhynchus nerka, Sebastes rastrelliger, Thymallus thymallus, Solea senegalensis, Coregonus clupeaformis, Torpedo californica, Thunnus thynnus, Cynoglossus semilaevis, Salvelinus fontinalis, Macaca mulatta



ABOUT THIS RECORD

ID: MNEST028168
species: Macaca nemestrina
miRNA family: mir-9
source: miRBase, original name: mne-mir-9 (MI0002572)

Taxonomy by NCBI:
Macaca nemestrina Macaca Cercopithecinae Cercopithecidae Cercopithecoidea Catarrhini Simiiformes Haplorrhini Primates Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TCTTTGGTTATCTAGCTGTATGA

miRNA*
ATAAAGCTAGATAACCGAAAGTA

mismatches: 3
bulges: 0

View larger
pre-miRNA
GGAAGCGAGTTGTTATCTTTGGTTATCTAGCTGTATGAGTGTATTGGTCTTCATAAAGCTAGATAACCGAAAGTAAAAACTCCTTCA

dot-bracket secondary structure
.((((.(((((.(((..(((((((((((((((.((((((..(....)..)))))).)))))))))))))))..))).))))))))).


SIMILARITIES
miRBase age-mir-9: 3e-44

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-9: 2e-17

Identical with: mml-mir-9-2 from miRBase (MNEST027646)

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record

references

[1] Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes"




Liczniki na strone;