miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Helianthus argophyllus, Helianthus ciliaris, Helianthus exilis, Helianthus paradoxus, Helianthus petiolaris, Helianthus tuberosus, Parthenium argentatum, Zinnia violacea, Helianthus annuus



ABOUT THIS RECORD

ID: MNEST045841
species: Helianthus tuberosus
miRNA family: MIR159
source: microPC, original name: miR159

Taxonomy by NCBI:
Helianthus tuberosus Helianthus Heliantheae Heliantheae alliance Asteroideae Asteraceae Asterales campanulids asterids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TTTGGATTGAAGGGAGCTCTA

miRNA*
GAGCTCCTTAAAGTCCAATAG

mismatches: 3
bulges: 0

View larger
pre-miRNA
TAGAGCTCCTTAAAGTCCAATAGAAGATCTGAGTGAGAACATAGAGCTGCTAGTTTATGGATCCCTCAAGTCCTATCTTTGTTGATGTATAGGCTTTGTG
GCTTGCATACACTTGGAGCTTTATTACCCTCCTTATGATCCTTTTTTGGATTGAAGGGAGCTCTA


dot-bracket secondary structure
(((((((((((..(((((((.(((.((((((((.(((...((((((((.(.(((.((((.(..((.((((.((((((.........).))))).)))).)
)..).)))).))).).))))))))....))))))).)))).))).)))))))..)))))))))))



SIMILARITIES
miRBase sly-MIR159: 0.0000001

PMRD sly-miR159: 0.0000001

microPC miR159: 2e-90
UniProt no hits

RFAM MIR159: 0.000002

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
download this record





Liczniki na strone;