miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Helianthus argophyllus, Helianthus ciliaris, Helianthus exilis, Helianthus paradoxus, Helianthus petiolaris, Helianthus tuberosus, Helianthus annuus



ABOUT THIS RECORD

ID: MNEST003160
species: Helianthus annuus
miRNA family: MIR167
source: miRNEST

Taxonomy by NCBI:
Helianthus annuus Helianthus Heliantheae Heliantheae alliance Asteroideae Asteraceae Asterales campanulids asterids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TGAAGCTGCCAGCATGATCTG

miRNA*
GGTCATGGTTGCAGCTTCAAT

mismatches: 3
bulges: 0

View larger
pre-miRNA
GTTTATGTTTGTATGAGAGATTGAAGCTGCCAGCATGATCTGATAATGCCAAACTGATTTGCCTATGTGTTTTTGTGTCATGGTTTCTAGTGTGTATGTA
GATTAACTGTGTCTTGTGGGGTGTTCTAGTGTGTGTGTGTGTTTTCATGGTGTATCCAGTGTGTGTGTTTATGGGTAGGGTAAAGAAAGGTTAATCAGGT
CATGGTTGCAGCTTCAAT
TACTCATTACCAACAGTT


dot-bracket secondary structure
.....((((.(((((((.((((((((((((...(((((((((((.((((((.(((((..(((((.........((...(((((((((((.........))
))..)))))))...))..))))).)).))).)).))))(..(((((......((((((.............)))))).......)))))..).)))))))
))))...)))))))))))
).)))).))).))))...



SIMILARITIES
miRBase csi-MIR167c: 0.0000000008

PMRD ppl-miR167b: 0.00000005

microPC miR167: 6e-23
UniProt no hits

RFAM MIR167_1: 0.000000004
most similar mature miRNAs

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
download this record





Liczniki na strone;