miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Bicyclus anynana, Drosophila melanogaster, Bombyx mori, Aedes aegypti, Acyrthosiphon pisum, Culex quinquefasciatus, Anopheles gambiae, Dendroctonus ponderosae, Nasonia vitripennis, Drosophila simulans, Aphis gossypii, Glossina morsitans morsitans, Choristoneura fumiferana, Spodoptera frugiperda, Heliothis virescens, Locusta migratoria, Phlebotomus papatasi, Drosophila sechellia, Drosophila auraria, Nilaparvata lugens, Antheraea assama, Drosophila pseudoobscura, Teleopsis dalmanni, Lutzomyia longipalpis, Nasonia giraulti, Bombus terrestris, Myzus persicae, Drosophila willistoni, Drosophila ananassae, Solenopsis invicta, Drosophila virilis, Drosophila erecta, Drosophila grimshawi, Ceratitis capitata, Spodoptera littoralis, Peregrinus maidis, Samia cynthia ricini, Drosophila mojavensis, Danaus plexippus, Cochliomyia hominivorax, Anopheles stephensi, Diabrotica virgifera virgifera, Haematobia irritans irritans, Papilio xuthus, Onychiurus arcticus, Rhodnius prolixus, Polypedilum vanderplanki, Ostrinia nubilalis, Laupala kohalensis, Frankliniella occidentalis, Trichoplusia ni, Gryllus bimaculatus, Drosophila yakuba, Epiphyas postvittana, Apis mellifera, Tribolium castaneum



ABOUT THIS RECORD

ID: MNEST035400
species: Apis mellifera
miRNA family: mir-928
source: miRBase, original name: ame-mir-928 (MI0005749)

Taxonomy by NCBI:
Apis mellifera Apis Apini Apinae Apidae Apoidea Aculeata Apocrita Hymenoptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
CTGGCTGTGGAAGCTGGCGAA

miRNA*
CACCCAGTCCCCGTACAGTTACCTGTGGACCAATACCAGCACCGCGCCTGAA

mismatches: 6
bulges: 35

View larger
pre-miRNA
GTCCAGTATTCCTGGCTGTGGAAGCTGGCGAACGTCACCCAGTCCCCGTACAGTTACCTGTGGACCAATACCAGCACCGCGCCTGAATTAGTTGCGGGAC


dot-bracket secondary structure
((((.((((((..(((.((((..(((((.(.....).....((((....((((....)))))))).....))))).))))))).)))).....)).))))



SIMILARITIES
miRBase nvi-mir-928: 0.0000003

PMRD no hits

microPC no hits
UniProt sp|Q02280|KCNAE_DROME: 0.000000004

RFAM no hits

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: array, RTPCR

references

[1] Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG, Genome Biol. 8:R97(2007)., "Computational and transcriptional evidence for microRNAs in the honey bee genome"




Liczniki na strone;