miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Acyrthosiphon pisum, Myzus persicae



ABOUT THIS RECORD

ID: MNEST008435
species: Acyrthosiphon pisum
miRNA family: mir-1422
source: miRNEST

Taxonomy by NCBI:
Acyrthosiphon pisum Acyrthosiphon Macrosiphini Aphidinae Aphididae Aphidoidea Aphidomorpha Aphidiformes Sternorrhyncha Hemiptera Paraneoptera Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
CGGGAAGACTATGTTTTGTGG

miRNA*
AAGAACCACGGTTCCAGCC

mismatches: 4
bulges: 2

View larger
pre-miRNA
ATCCAAAAGTTCAAGAACCACGGTTCCAGCCAGGTGTCCAAGAGTTTCAGGATATGTTCCGAACACTTCAAGCGGGAAGACTATGTTTTGTGGACGTCGA
AA


dot-bracket secondary structure
........(((((.(((.((.((((((.((.((((((.........((.(((.....)))))))))))...)).)))..))).)).))).))))).....
..



SIMILARITIES
miRBase no hits

PMRD no hits

microPC no hits
UniProt no hits

RFAM no hits
most similar mature miRNAs

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: not a miRNA
Source sequences
download this record





Liczniki na strone;