miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Persea americana, Actinidia chinensis, Actinidia deliciosa, Actinidia eriantha, Agrostis stolonifera, Allium cepa, Amborella trichopoda, Antirrhinum majus, Aquilegia formosa x Aquilegia pubescens, Arachis duranensis, Oryza sativa, Arachis hypogaea, Arachis ipaensis, Aristolochia fimbriata, Avena barbata, Avena sativa, Barnadesia spinosa, Beta vulgaris, Brassica napus, Brassica oleracea var. alboglabra, Brassica rapa, Cichorium intybus, Citrus aurantium, Citrus reticulata, Citrus sinensis, Citrus unshiu, Coffea canephora, Cucumis melo subsp. melo, Curcuma longa, Cynodon dactylon, Dioscorea alata, Elaeis guineensis, Eragrostis curvula, Eschscholzia californica, Eucalyptus globulus, Eucalyptus gunnii, Euonymus alatus, Euphorbia esula, Fagus sylvatica, Festuca arundinacea, Festuca pratensis, Fragaria vesca, Fragaria x ananassa, Fraxinus excelsior, Gerbera hybrid cultivar, Glycine soja, Glycyrrhiza uralensis, Gossypium arboreum, Gossypium hirsutum, Gossypium raimondii, Guizotia abyssinica, Helianthus argophyllus, Helianthus ciliaris, Helianthus exilis, Helianthus paradoxus, Helianthus petiolaris, Helianthus tuberosus, Hevea brasiliensis, Hordeum vulgare, Hordeum vulgare subsp. spontaneum, Humulus lupulus, Ipomoea batatas, Jatropha curcas, Juglans hindsii x Juglans regia, Lactuca perennis, Lactuca saligna, Lactuca sativa, Lactuca serriola, Lactuca virosa, Leymus cinereus x Leymus triticoides, Limnanthes alba, Linum usitatissimum, Liriodendron tulipifera, Lolium perenne, Lotus japonicus, Manihot esculenta, Medicago sativa, Mesembryanthemum crystallinum, Mimulus guttatus, Mimulus guttatus var. nasutus, Mimulus lewisii, Musa ABB Group, Nicotiana benthamiana, Nicotiana langsdorffii x Nicotiana sanderae, Nicotiana tabacum, Nuphar advena, Ocimum basilicum, Panax ginseng, Panicum virgatum, Papaver somniferum, Parthenium argentatum, Paullinia cupana var. sorbilis, Petunia axillaris subsp. axillaris, Phaseolus acutifolius, Phaseolus coccineus, Pisum sativum, Populus deltoides, Populus euphratica, Populus nigra, Populus tremula, Populus tremula x Populus alba, Populus tremula x Populus tremuloides, Populus tremuloides, Populus trichocarpa x Populus nigra, Populus x canadensis, Prunus armeniaca, Prunus persica, Pseudoroegneria spicata, Quercus petraea, Quercus robur, Raphanus raphanistrum, Raphanus raphanistrum subsp. landra, Raphanus raphanistrum subsp. maritimus, Raphanus sativus, Raphanus sativus var. oleiformis, Saccharum hybrid cultivar CoS 767, Saccharum hybrid cultivar SP70-1143, Saccharum officinarum, Salvia miltiorrhiza, Saruma henryi, Solanum habrochaites, Solanum lycopersicum, Solanum melongena, Solanum pennellii, Solanum torvum, Sorghum propinquum, Striga hermonthica, Tamarix hispida, Taraxacum kok-saghyz, Taraxacum officinale, Thellungiella halophila, Theobroma cacao, Trifolium pratense, Triphysaria pusilla, Triphysaria versicolor, Triticum monococcum, Triticum turgidum subsp. durum, Tropaeolum majus, Vitis shuttleworthii, Zingiber officinale, Zinnia violacea, Bruguiera gymnorhiza, Cajanus cajan, Carica papaya, Capsicum annuum, Carthamus tinctorius, Catharanthus roseus, Cenchrus ciliaris, Centaurea maculosa, Centaurea solstitialis, Cicer arietinum, Cichorium endivia, Artemisia annua, Brachypodium distachyon, Citrus clementina, Helianthus annuus, Glycine max, Arabidopsis thaliana, Zea mays, Triticum aestivum, Solanum tuberosum, Vigna unguiculata, Vitis vinifera, Medicago truncatula, Sorghum bicolor, Brassica oleracea, Populus trichocarpa, Phaseolus vulgaris, Ricinus communis, Ipomoea nil, Populus trichocarpa x Populus deltoides



ABOUT THIS RECORD

ID: MNEST001128
species: Hordeum vulgare
miRNA family: MIR1436
source: miRNEST

Taxonomy by NCBI:
Hordeum vulgare Hordeum Triticeae Pooideae BEP clade Poaceae Poales commelinids Liliopsida Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TTATTTTGGGACGGAGGGAGT

miRNA*
TCCCTCCGTTCCAAAATAAGT

mismatches: 0
bulges: 0

View larger
pre-miRNA
CTTTGCCTTGTACTCCCTCCGTTCCAAAATAAGTGTCTCAACTTTGTACTAGTTCTAGTACAAAGTTGTACTAAGCTTGAGACAGTTATTTTGGGACGGA
GGGAGT
AGAATCTAAA


dot-bracket secondary structure
..........((((((((((((((((((((((.((((((((((((((((((....))))))))))).((.....)).))))))).)))))))))))))))
))))))
).........



SIMILARITIES
miRBase far-MIR1122: 0.00000002

PMRD hpr-miR1120: 0.000000001

microPC miR1439: 5e-31
UniProt no hits

RFAM MIR1122: 2e-39
most similar mature miRNAs

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
degradome data
download this record





Liczniki na strone;