miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Mus musculus, Rattus norvegicus, Peromyscus maniculatus bairdii, Peromyscus polionotus subgriseus



ABOUT THIS RECORD

ID: MNEST004989
species: Mus musculus
miRNA family: miR-3526
source: miRNEST

Taxonomy by NCBI:
Mus musculus Mus Mus Murinae Muridae Muroidea Sciurognathi Rodentia Glires Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
GTGAAGATGAAGTTGGTGTTC

miRNA*
AAATAAAGCTACATATCATGC

mismatches: 4
bulges: 2

View larger
pre-miRNA
CTATCCTGCCAGTGAAGATGAAGTTGGTGTTCTTTGAAAATAAAGCTACATATCATGCCC

dot-bracket secondary structure
...........((((..(((.((((.((.(((...))).))..)))).))).))))....


SIMILARITIES
miRBase no hits

PMRD no hits

microPC no hits
UniProt no hits

RFAM no hits
most similar mature miRNAs

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: not a miRNA
Source sequences
download this record





Liczniki na strone;