miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Mus musculus, Mus musculus



ABOUT THIS RECORD

ID: MNEST004995
species: Mus musculus
miRNA family: mir-72
source: miRNEST

Taxonomy by NCBI:
Mus musculus Mus Mus Murinae Muridae Muroidea Sciurognathi Rodentia Glires Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
AGGCAGAGGCTGGCAGATCTC

miRNA*
GATCTGCCTCTTTTTGCAGGG

mismatches: 4
bulges: 0

View larger
pre-miRNA
TGAACTTACAGAGATCTGCCTCTTTTTGCAGGGCTCTAAGGTTTGTATCATTGTCTTTGGCCAAACACTGATATTAATGCTCTTTAAAGGAAGAGAGGAG
ATTTGCGTGGTGATGGCACACACTTTTAATGCCAGCACTCATGAGGCAGAGGCTGGCAGATCTCTGTGAATTT


dot-bracket secondary structure
.(((.(((((((((((((((..(((((((.((.((((...(((.((((((.(((..........))).)))))).))).((((((....)))))).))))
..)).(((((((.(((((...........))))).))).))))..)))))))..))))))))))))))).)))



SIMILARITIES
miRBase mmu-mir-3470a: 0.0000000006

PMRD no hits

microPC no hits
UniProt no hits

RFAM Metazoa_SRP: 0.0006
most similar mature miRNAs

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
download this record





Liczniki na strone;