miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Populus trichocarpa



ABOUT THIS RECORD

ID: MNEST052627
species: Populus trichocarpa
source: PMRD, original name: ptc-miRf10805-akr

Taxonomy by NCBI:
Populus trichocarpa Populus Saliceae Salicaceae Malpighiales fabids rosids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
GTCTCGATACCAATCCCAACATTG

miRNA*
ATGTTGGGATACATATCGAGACTT

mismatches: 3
bulges: 0

View larger
pre-miRNA
TTATCAATGTTGGGATACATATCGAGACTTGCTTAATACTTGCCTTCATCATGGTTTTGGAAACATGGAGATTGGTAAGTTAGCAACATTGGTAAGTATT
AAGCATGTCTCGATACCAATCCCAACATTGGTAA


dot-bracket secondary structure
.(((((((((((((((...(((((((((.(((((((((((((((.((..((((..........))))..))...((......))......))))))))))
))))).)))))))))...))))))))))))))).



SIMILARITIES
miRBase no hits

PMRD ptc-miRf11699-akr: 4e-72

microPC no hits
UniProt no hits

RFAM snoR71: 0.000000000000002

Identical with: ptc-miRf10393-akr from PMRD (MNEST052215)

MORE

miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record





Liczniki na strone;