miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Bicyclus anynana, Drosophila melanogaster, Bombyx mori, Aedes aegypti, Aplysia californica, Lottia gigantea, Alvinella pompejana, Ixodes scapularis, Litopenaeus vannamei, Lepeophtheirus salmonis, Acyrthosiphon pisum, Culex quinquefasciatus, Anopheles gambiae, Dendroctonus ponderosae, Daphnia pulex, Nasonia vitripennis, Drosophila simulans, Helobdella robusta, Petrolisthes cinctipes, Aphis gossypii, Tetranychus urticae, Glossina morsitans morsitans, Choristoneura fumiferana, Spodoptera frugiperda, Heliothis virescens, Crassostrea gigas, Biomphalaria glabrata, Rhipicephalus microplus, Locusta migratoria, Phlebotomus papatasi, Mytilus californianus, Penaeus monodon, Drosophila sechellia, Drosophila auraria, Artemia franciscana, Nilaparvata lugens, Euprymna scolopes, Antheraea assama, Drosophila pseudoobscura, Teleopsis dalmanni, Lutzomyia longipalpis, Caligus rogercresseyi, Nasonia giraulti, Homarus americanus, Bombus terrestris, Myzus persicae, Drosophila willistoni, Drosophila ananassae, Solenopsis invicta, Drosophila virilis, Drosophila erecta, Drosophila grimshawi, Ceratitis capitata, Spodoptera littoralis, Peregrinus maidis, Samia cynthia ricini, Lumbricus rubellus, Drosophila mojavensis, Danaus plexippus, Rhipicephalus appendiculatus, Cochliomyia hominivorax, Anopheles stephensi, Diabrotica virgifera virgifera, Tubifex tubifex, Haematobia irritans irritans, Eriocheir sinensis, Papilio xuthus, Onychiurus arcticus, Rhodnius prolixus, Carcinus maenas, Polypedilum vanderplanki, Ostrinia nubilalis, Lernaeocera branchialis, Caligus clemensi, Laupala kohalensis, Frankliniella occidentalis, Daphnia magna, Gammarus pulex, Trichoplusia ni, Lymnaea stagnalis, Calanus finmarchicus, Gryllus bimaculatus, Drosophila yakuba, Epiphyas postvittana, Callinectes sapidus, Peripatopsis sedgwicki, Fenneropenaeus chinensis, Apis mellifera, Tribolium castaneum



ABOUT THIS RECORD

ID: MNEST035087
species: Acyrthosiphon pisum
source: miRBase, original name: api-mir-317 (MI0013934)

Taxonomy by NCBI:
Acyrthosiphon pisum Acyrthosiphon Macrosiphini Aphidinae Aphididae Aphidoidea Aphidomorpha Aphidiformes Sternorrhyncha Hemiptera Paraneoptera Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TGAACACAGCTGGTGGTATCT

miRNA*


mismatches: 5
bulges: 2

View larger
pre-miRNA
AACCTCGCTGTGTTAACTTGTCATGTTATTTCGATAATTATTCGATGAAATCAGAGTGAACACAGCTGGTGGTATCT

dot-bracket secondary structure
.(((((((((((((.((((......((...((((.......))))..))....)))).)))))))).)).)))....


SIMILARITIES
miRBase bmo-mir-317: 0.0000009

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-317: 4e-37

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: Solexa

references

[1] Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S, BMC Genomics. 11:281(2010)., "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum"




Liczniki na strone;