miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Mus musculus, Rattus norvegicus, Peromyscus maniculatus bairdii, Cavia porcellus, Peromyscus polionotus subgriseus



ABOUT THIS RECORD

ID: MNEST004969
species: Mus musculus
miRNA family: mir-1227
source: miRNEST

Taxonomy by NCBI:
Mus musculus Mus Mus Murinae Muridae Muroidea Sciurognathi Rodentia Glires Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
GATGGGCCAGGCGGTGGTGGC

miRNA*
CAAGCCAGCCTGGTCTACAGA

mismatches: 4
bulges: 2

View larger
pre-miRNA
TAAGGAAGCAAGATGGGCCAGGCGGTGGTGGCGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGACGGATTTCTGAGTTCCAAGCCAGCCTGGT
CTACAGA
GTGAGTTC


dot-bracket secondary structure
...(((..((...(((((((((((((..(((.((..((((((..(((((.....)))))...))))))...(((....))).)).))).))).)))))))
)))....
.))..)))



SIMILARITIES
miRBase mmu-mir-3470b: 7e-21

PMRD ptc-miRf12412-akr: 0.00009

microPC no hits
UniProt no hits

RFAM Metazoa_SRP: 0.000000002
most similar mature miRNAs

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
download this record





Liczniki na strone;