miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Mus musculus, Rattus norvegicus, Peromyscus maniculatus bairdii, Cavia porcellus, Peromyscus polionotus subgriseus



ABOUT THIS RECORD

ID: MNEST004996
species: Mus musculus
miRNA family: miR-1930
source: miRNEST

Taxonomy by NCBI:
Mus musculus Mus Mus Murinae Muridae Muroidea Sciurognathi Rodentia Glires Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
ACCTCCATAGTACCTGCAGCGT

miRNA*
GGTGCAGTTACTGTGGCTGTGG

mismatches: 4
bulges: 0

View larger
pre-miRNA
CTGGACCACATGCCCACGGTCACCTCCATAGTACCTGCAGCGTGCTTGACTTTCTCTATGGTGCAGTTACTGTGGCTGTGGCTGTGTTCGTGCCTCAGA

dot-bracket secondary structure
((((....((((..(((((((((..((((((((.(((((.((((...((...))..)))).))))).))))))))..)))))))))..))))..)))).


SIMILARITIES
miRBase mmu-mir-1930: 2e-42

PMRD no hits

microPC no hits
UniProt no hits

RFAM no hits
most similar mature miRNAs

Identical with: mmu-mir-1930 from miRBase (MNEST032434)

MORE

miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
Source sequences
download this record
deep sequencing data evidence





Liczniki na strone;