miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Nicotiana benthamiana, Nicotiana langsdorffii x Nicotiana sanderae, Nicotiana tabacum, Petunia axillaris subsp. axillaris, Solanum habrochaites, Solanum lycopersicum, Solanum melongena, Solanum pennellii, Solanum torvum, Capsicum annuum, Solanum tuberosum



ABOUT THIS RECORD

ID: MNEST045455
species: Solanum tuberosum
source: microPC, original name: miR396

Taxonomy by NCBI:
Solanum tuberosum Solanum Solaneae Solanoideae Solanaceae Solanales lamiids asterids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TTCCACAGCTTTCTTGAAC

miRNA*
CCAAGAAAGCTGTGGGA

mismatches: 1
bulges: 0

View larger
pre-miRNA
TTCCACAGCTTTCTTGAACTTCTTCTTGCTAAATTTTGATCTCTAAATTGATAATTTTGAGATGAAATTTTTGAAGCTATGAAAGTCCAAGAAAGCTGTG
GGA


dot-bracket secondary structure
((((((((((((((((.((((..((..((((((.(((.(((((.((((.....)))).))))).))).)))...)))...)))))).)))))))))))))
)))



SIMILARITIES
miRBase zma-MIR396f: 0.00000002

PMRD zma-miR396g: 0.00000002

microPC miR396: 9e-54
UniProt no hits

RFAM MIR396: 0.0000004

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
download this record





Liczniki na strone;