miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Solanum habrochaites, Solanum lycopersicum, Solanum melongena, Solanum pennellii, Solanum torvum, Capsicum annuum, Solanum tuberosum



ABOUT THIS RECORD

ID: MNEST007361
species: Solanum tuberosum
miRNA family: MIR166
source: miRNEST

Taxonomy by NCBI:
Solanum tuberosum Solanum Solaneae Solanoideae Solanaceae Solanales lamiids asterids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TCGGACCAGGCTTCATTCCTC

miRNA*
GGGATGTTGTTTGGCTCGACA

mismatches: 3
bulges: 0

View larger
pre-miRNA
TTGTGTGTGGTGAGTTTGAGGGGGATGTTGTTTGGCTCGACACAATTACTCTCTTGTATGTGTTTATTTATTCGTCATCAAGATTGATGTTGATAACGAA
TAAATTAAACACAACAAGATATGTAAAAAGGGAGTAAAGGCGTCGGACCAGGCTTCATTCCTCTCAAACAATATTCTACTT


dot-bracket secondary structure
....(((.((((.((((((((((((((..((((((.(((((....((((((((((...(((((((((((((((((.(((((........))))).)))))
)))).))))))))(((.....)))...))))))))))....))))).))))))..))))))))))))))..)))).)))..



SIMILARITIES
miRBase zma-MIR166m: 0.000000009

PMRD zma-miR166m: 0.000000009

microPC miR166: 0.0001
UniProt no hits

RFAM mir-166: 0.0000002
most similar mature miRNAs

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
download this record





Liczniki na strone;