miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Persea americana, Actinidia chinensis, Actinidia deliciosa, Actinidia eriantha, Adiantum capillus-veneris, Agrostis stolonifera, Allium cepa, Amborella trichopoda, Antirrhinum majus, Aquilegia formosa x Aquilegia pubescens, Arachis duranensis, Oryza sativa, Arachis hypogaea, Arachis ipaensis, Aristolochia fimbriata, Avena barbata, Avena sativa, Barnadesia spinosa, Beta vulgaris, Botryococcus braunii, Brassica napus, Brassica oleracea var. alboglabra, Brassica rapa, Cichorium intybus, Citrus aurantium, Citrus reticulata, Citrus sinensis, Citrus unshiu, Coccomyxa sp. C-169, Coffea canephora, Cryptomeria japonica, Cucumis melo subsp. melo, Curcuma longa, Cycas rumphii, Cynodon dactylon, Dioscorea alata, Elaeis guineensis, Eragrostis curvula, Eschscholzia californica, Eucalyptus globulus, Eucalyptus gunnii, Euonymus alatus, Euphorbia esula, Fagus sylvatica, Festuca arundinacea, Festuca pratensis, Fragaria vesca, Fragaria x ananassa, Fraxinus excelsior, Gerbera hybrid cultivar, Glycine soja, Glycyrrhiza uralensis, Gnetum gnemon, Gossypium arboreum, Gossypium hirsutum, Gossypium raimondii, Guizotia abyssinica, Helianthus argophyllus, Helianthus ciliaris, Helianthus exilis, Helianthus paradoxus, Helianthus petiolaris, Helianthus tuberosus, Hevea brasiliensis, Hordeum vulgare, Hordeum vulgare subsp. spontaneum, Humulus lupulus, Ipomoea batatas, Jatropha curcas, Juglans hindsii x Juglans regia, Lactuca perennis, Lactuca saligna, Lactuca sativa, Lactuca serriola, Lactuca virosa, Leymus cinereus x Leymus triticoides, Limnanthes alba, Linum usitatissimum, Liriodendron tulipifera, Lolium perenne, Lotus japonicus, Manihot esculenta, Medicago sativa, Mesembryanthemum crystallinum, Mesostigma viride, Mimulus guttatus, Mimulus guttatus var. nasutus, Mimulus lewisii, Musa ABB Group, Nicotiana benthamiana, Nicotiana langsdorffii x Nicotiana sanderae, Nicotiana tabacum, Nuphar advena, Ocimum basilicum, Panax ginseng, Panicum virgatum, Papaver somniferum, Parthenium argentatum, Paullinia cupana var. sorbilis, Petunia axillaris subsp. axillaris, Phaseolus acutifolius, Phaseolus coccineus, Picea abies, Picea engelmannii x Picea glauca, Picea glauca, Picea sitchensis, Pinus banksiana, Pinus contorta, Pinus pinaster, Pinus taeda, Pisum sativum, Populus deltoides, Populus euphratica, Populus nigra, Populus tremula, Populus tremula x Populus alba, Populus tremula x Populus tremuloides, Populus tremuloides, Populus trichocarpa x Populus nigra, Populus x canadensis, Prunus armeniaca, Prunus persica, Pseudoroegneria spicata, Pseudotsuga menziesii var. menziesii, Quercus petraea, Quercus robur, Raphanus raphanistrum, Raphanus raphanistrum subsp. landra, Raphanus raphanistrum subsp. maritimus, Raphanus sativus, Raphanus sativus var. oleiformis, Saccharum hybrid cultivar CoS 767, Saccharum hybrid cultivar SP70-1143, Saccharum officinarum, Salvia miltiorrhiza, Saruma henryi, Solanum habrochaites, Solanum lycopersicum, Solanum melongena, Solanum pennellii, Solanum torvum, Sorghum propinquum, Striga hermonthica, Tamarix hispida, Taraxacum kok-saghyz, Taraxacum officinale, Thellungiella halophila, Theobroma cacao, Trifolium pratense, Triphysaria pusilla, Triphysaria versicolor, Triticum monococcum, Triticum turgidum subsp. durum, Tropaeolum majus, Vitis shuttleworthii, Volvox carteri, Welwitschia mirabilis, Zamia vazquezii, Zingiber officinale, Zinnia violacea, Bruguiera gymnorhiza, Cajanus cajan, Carica papaya, Capsicum annuum, Carthamus tinctorius, Catharanthus roseus, Cenchrus ciliaris, Centaurea maculosa, Centaurea solstitialis, Cicer arietinum, Cichorium endivia, Artemisia annua, Brachypodium distachyon, Citrus clementina, Helianthus annuus, Glycine max, Arabidopsis thaliana, Zea mays, Triticum aestivum, Physcomitrella patens, Solanum tuberosum, Vigna unguiculata, Vitis vinifera, Medicago truncatula, Sorghum bicolor, Chlamydomonas reinhardtii, Brassica oleracea, Populus trichocarpa, Phaseolus vulgaris, Ricinus communis, Ipomoea nil, Populus trichocarpa x Populus deltoides



ABOUT THIS RECORD

ID: MNEST045455
species: Solanum tuberosum
source: microPC, original name: miR396

Taxonomy by NCBI:
Solanum tuberosum Solanum Solaneae Solanoideae Solanaceae Solanales lamiids asterids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TTCCACAGCTTTCTTGAAC

miRNA*
CCAAGAAAGCTGTGGGA

mismatches: 1
bulges: 0

View larger
pre-miRNA
TTCCACAGCTTTCTTGAACTTCTTCTTGCTAAATTTTGATCTCTAAATTGATAATTTTGAGATGAAATTTTTGAAGCTATGAAAGTCCAAGAAAGCTGTG
GGA


dot-bracket secondary structure
((((((((((((((((.((((..((..((((((.(((.(((((.((((.....)))).))))).))).)))...)))...)))))).)))))))))))))
)))



SIMILARITIES
miRBase zma-MIR396f: 0.00000002

PMRD zma-miR396g: 0.00000002

microPC miR396: 9e-54
UniProt no hits

RFAM MIR396: 0.0000004

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
download this record





Liczniki na strone;