miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Actinidia chinensis, Actinidia deliciosa, Actinidia eriantha, Antirrhinum majus, Barnadesia spinosa, Cichorium intybus, Coffea canephora, Fraxinus excelsior, Gerbera hybrid cultivar, Guizotia abyssinica, Helianthus argophyllus, Helianthus ciliaris, Helianthus exilis, Helianthus paradoxus, Helianthus petiolaris, Helianthus tuberosus, Ipomoea batatas, Lactuca perennis, Lactuca saligna, Lactuca sativa, Lactuca serriola, Lactuca virosa, Mimulus guttatus, Mimulus guttatus var. nasutus, Mimulus lewisii, Nicotiana benthamiana, Nicotiana langsdorffii x Nicotiana sanderae, Nicotiana tabacum, Ocimum basilicum, Panax ginseng, Parthenium argentatum, Petunia axillaris subsp. axillaris, Salvia miltiorrhiza, Solanum habrochaites, Solanum lycopersicum, Solanum melongena, Solanum pennellii, Solanum torvum, Striga hermonthica, Taraxacum kok-saghyz, Taraxacum officinale, Triphysaria pusilla, Triphysaria versicolor, Zinnia violacea, Capsicum annuum, Carthamus tinctorius, Catharanthus roseus, Centaurea maculosa, Centaurea solstitialis, Cichorium endivia, Artemisia annua, Helianthus annuus, Solanum tuberosum, Ipomoea nil



ABOUT THIS RECORD

ID: MNEST000895
species: Helianthus tuberosus
miRNA family: MIRf58
source: miRNEST

Taxonomy by NCBI:
Helianthus tuberosus Helianthus Heliantheae Heliantheae alliance Asteroideae Asteraceae Asterales campanulids asterids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
GATCATGCGATCTCTTCGGAA

miRNA*
CCAAGGGATCGCATTGATCCA

mismatches: 0
bulges: 2

View larger
pre-miRNA
CGGGTTGAGCTTCCAAGGGATCGCATTGATCCATCTGTCCACTCGGATTTCAATCTCAGTTGATAATTTGGATCATGCGATCTCTTCGGAAGCTTCCTCC


dot-bracket secondary structure
.(((..((((((((((((((((((((.((((((..((((.(((.((((....)))).))).))))...)))))))))))))))))).)))))))))))..



SIMILARITIES
miRBase zma-MIR393b: 0.00007

PMRD zma-miR393f: 0.00007

microPC miR393: 1e-37
UniProt no hits

RFAM no hits
most similar mature miRNAs

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: true miRNA
Source sequences
download this record





Liczniki na strone;