miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Barnadesia spinosa, Cichorium intybus, Gerbera hybrid cultivar, Guizotia abyssinica, Helianthus argophyllus, Helianthus ciliaris, Helianthus exilis, Helianthus paradoxus, Helianthus petiolaris, Helianthus tuberosus, Lactuca perennis, Lactuca saligna, Lactuca sativa, Lactuca serriola, Lactuca virosa, Panax ginseng, Parthenium argentatum, Taraxacum kok-saghyz, Taraxacum officinale, Zinnia violacea, Carthamus tinctorius, Centaurea maculosa, Centaurea solstitialis, Cichorium endivia, Artemisia annua, Helianthus annuus



ABOUT THIS RECORD

ID: MNEST000890
species: Helianthus tuberosus
miRNA family: MIRf319
source: miRNEST

Taxonomy by NCBI:
Helianthus tuberosus Helianthus Heliantheae Heliantheae alliance Asteroideae Asteraceae Asterales campanulids asterids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
GATGAGCTCTTGAAAAGAAAC

miRNA*
TTATTTTCTTGCTTCTCCA

mismatches: 4
bulges: 2

View larger
pre-miRNA
CAGTCTACTGCACCGGAGGAAGATGAGCTCTTGAAAAGAAACACCGATTGCGTTTATTTTCTTGCTTCTCCATTAACCTGCAAAAAGGGA

dot-bracket secondary structure
...(((.(((...))).))).((.((((....(((((.((((.........)))).)))))..)))).))......(((......)))..


SIMILARITIES
miRBase no hits

PMRD no hits

microPC no hits
UniProt sp|Q0J952|C3H32_ORYSJ: 0.000003

RFAM no hits
most similar mature miRNAs

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: not a miRNA
Source sequences
download this record





Liczniki na strone;