miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Actinidia chinensis, Actinidia deliciosa, Actinidia eriantha, Antirrhinum majus, Aquilegia formosa x Aquilegia pubescens, Arachis duranensis, Arachis hypogaea, Arachis ipaensis, Barnadesia spinosa, Beta vulgaris, Brassica napus, Brassica oleracea var. alboglabra, Brassica rapa, Cichorium intybus, Citrus aurantium, Citrus reticulata, Citrus sinensis, Citrus unshiu, Coffea canephora, Cucumis melo subsp. melo, Eschscholzia californica, Eucalyptus globulus, Eucalyptus gunnii, Euonymus alatus, Euphorbia esula, Fagus sylvatica, Fragaria vesca, Fragaria x ananassa, Fraxinus excelsior, Gerbera hybrid cultivar, Glycine soja, Glycyrrhiza uralensis, Gossypium arboreum, Gossypium hirsutum, Gossypium raimondii, Guizotia abyssinica, Helianthus argophyllus, Helianthus ciliaris, Helianthus exilis, Helianthus paradoxus, Helianthus petiolaris, Helianthus tuberosus, Hevea brasiliensis, Humulus lupulus, Ipomoea batatas, Jatropha curcas, Juglans hindsii x Juglans regia, Lactuca perennis, Lactuca saligna, Lactuca sativa, Lactuca serriola, Lactuca virosa, Limnanthes alba, Linum usitatissimum, Lotus japonicus, Manihot esculenta, Medicago sativa, Mesembryanthemum crystallinum, Mimulus guttatus, Mimulus guttatus var. nasutus, Mimulus lewisii, Nicotiana benthamiana, Nicotiana langsdorffii x Nicotiana sanderae, Nicotiana tabacum, Ocimum basilicum, Panax ginseng, Papaver somniferum, Parthenium argentatum, Paullinia cupana var. sorbilis, Petunia axillaris subsp. axillaris, Phaseolus acutifolius, Phaseolus coccineus, Pisum sativum, Populus deltoides, Populus euphratica, Populus nigra, Populus tremula, Populus tremula x Populus alba, Populus tremula x Populus tremuloides, Populus tremuloides, Populus trichocarpa x Populus nigra, Populus x canadensis, Prunus armeniaca, Prunus persica, Quercus petraea, Quercus robur, Raphanus raphanistrum, Raphanus raphanistrum subsp. landra, Raphanus raphanistrum subsp. maritimus, Raphanus sativus, Raphanus sativus var. oleiformis, Salvia miltiorrhiza, Solanum habrochaites, Solanum lycopersicum, Solanum melongena, Solanum pennellii, Solanum torvum, Striga hermonthica, Tamarix hispida, Taraxacum kok-saghyz, Taraxacum officinale, Thellungiella halophila, Theobroma cacao, Trifolium pratense, Triphysaria pusilla, Triphysaria versicolor, Tropaeolum majus, Vitis shuttleworthii, Zinnia violacea, Bruguiera gymnorhiza, Cajanus cajan, Carica papaya, Capsicum annuum, Carthamus tinctorius, Catharanthus roseus, Centaurea maculosa, Centaurea solstitialis, Cicer arietinum, Cichorium endivia, Artemisia annua, Citrus clementina, Helianthus annuus, Glycine max, Arabidopsis thaliana, Solanum tuberosum, Vigna unguiculata, Vitis vinifera, Medicago truncatula, Brassica oleracea, Populus trichocarpa, Phaseolus vulgaris, Ricinus communis, Ipomoea nil, Populus trichocarpa x Populus deltoides



ABOUT THIS RECORD

ID: MNEST000892
species: Helianthus tuberosus
miRNA family: MIR414
source: miRNEST

Taxonomy by NCBI:
Helianthus tuberosus Helianthus Heliantheae Heliantheae alliance Asteroideae Asteraceae Asterales campanulids asterids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
ATTTCTTCATCATCATCATCG

miRNA*
CTGATTATGGGAGGTATAG

mismatches: 3
bulges: 2

View larger
pre-miRNA
TTTATATCCAGATTTCTTCATCATCATCATCGCCTGCAACTAAACCACAACCGATCAACATTCTTTCTTTCTTACTCCATGACAATAGTGAAAGGACCTG
CTTCCAACCTAAATCTTTCCGAAGCTGACGATAAGAACTTGGAGTTTTTGATAGAAGCTTTCGGTTCAATGATATCTCCCGATGACATGGCGTCCGCGTA
CTGCCAAGCGGGATACGATCTAAATAAAGCAAGTGATATACTATATGCTATGCTCGGAAGCTCTTCCAACAACGACAAATACATACCAACAGAAGATTCG
ACTAGAGCACCTGCATCATCAGTCGGTGTAACCGTCGGTACAGTTTCTGGTGTTAACGGTGCTTACTATCCAACATCAAGAACTTCAACCAACGAACCTG
CAACGGTTCTTTCTAGAGCTAAGCTCAGAACCTCTGGTGTATCAGTGGGTACGGTATCGGGTATAATCGGTGCTGATTATGGGAGGTATAGGGCTAATG


dot-bracket secondary structure
....((.((..((..((((.((((.((((.((((......((.(((..((((((......((((.((......((((((.......(((..........(
((((................)))))...........)))))))))....)).))))....))))))...(((((((.((((.(((..(((((........
.))))).(((((......((((..((.((((.(((......))).)))).)).(((((...(((((.........................)))))))))
).))))...)))))..((((((.((((...))))..(((..(((((.(((((((...((((.....)))).))))))).)))))...)))...(((((..
....))))).((((.((((...))))))))...))))))..))).))))...)))))))))).))...)))).)))).)))))))).))..)).))...



SIMILARITIES
miRBase no hits

PMRD no hits

microPC no hits
UniProt no hits

RFAM no hits
most similar mature miRNAs

MORE

miRNEST target predictions
non-miRNEST targets: none
HuntMi prediction: not a miRNA
Source sequences
download this record





Liczniki na strone;