| Basic information from miRBase |
| hairpin accession number: MI0008473 |
| Located between position 62360583 and 62360710 on chromosome 15 strand - |
| Overlapping with sense strand of XM_001174270.1 (intron 1). |
| (Ensemble: ENSPTRT00000013220) |
| mature miRNAs for MI0008473: |
| ptr-miR-1272 (MIMAT0007993): GATGATGATGGCAGCAAATTCTGAAA |
| You can find this miRNA in ENTREZGENE: MIR1272 (accession: 100316072) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |