| Basic information from miRBase |
| hairpin accession number: MI0001961 |
| Located between position 1946477 and 1946588 on chromosome 5 strand - |
| Overlapping with sense strand of rcl1-201 (intron 8). |
| (Ensemble: ENSDART00000055878) |
| mature miRNAs for MI0001961: |
| dre-miR-101b (MIMAT0001815): TACAGTACTATGATAACTGAAG |
| You can find this miRNA in ENTREZGENE: mir101b (accession: 100033624) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |