Basic information from miRBase |
hairpin accession number: MI0008486 |
Located between position 91828316 and 91828398 on chromosome 7 strand - |
Overlapping with sense strand of XM_001165812.1 (intron 16). |
(Ensemble: ENSPTRT00000035895) |
mature miRNAs for MI0008486: |
ptr-miR-1285 (MIMAT0008004): TCTGGGCAACAAAGTGAGACCT |
You can find this miRNA in ENTREZGENE: MIR1285 (accession: 100316078) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |