| Basic information from miRBase |
| hairpin accession number: MI0008488 |
| Located between position 2276797 and 2276870 on chromosome 17_random strand + |
| Overlapping with sense strand of (intron 2). |
| (Ensemble: ENSPTRT00000067108) |
| mature miRNAs for MI0008488: |
| ptr-miR-1288 (MIMAT0008006): TGGACTGCCCTGATCTGGAGA |
| You can find this miRNA in ENTREZGENE: MIR1288 (accession: 100316080) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |