| Basic information from miRBase |
| hairpin accession number: MI0015955 |
| Located between position 14765 and 14847 on chromosome GroupUn.3013 strand - |
| mature miRNAs for MI0015955: |
| ame-miR-1 (MIMAT0001471): TGGAATGTAAAGAAGTATGGAG |
| You can find this miRNA in ENTREZGENE: Mir1 (accession: 732491) |
| References |
| [1]Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG, Genome Biol. 8:R97(2007)., "Computational and transcriptional evidence for microRNAs in the honey bee genome" |