| Basic information from miRBase |
| hairpin accession number: MI0016138 |
| Located between position 1180906 and 1181024 on chromosome Group1.1 strand - |
| mature miRNAs for MI0016138: |
| ame-miR-193 (MIMAT0018508): TACTGGCCTGCTAAGTCCCAA |
| References |
| [1]Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F, Insect Mol Biol. 19:799-805(2010)., "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" |