| Basic information from miRBase |
| hairpin accession number: MI0001590 |
| Located between position 134955 and 135038 on chromosome Group1.1 strand - |
| mature miRNAs for MI0001590: |
| ame-miR-2 (MIMAT0001485): TATCACAGCCAGCTTTGATGAGC |
| You can find this miRNA in ENTREZGENE: Mir2-2 (accession: 732506) |
| References |
| [1]Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG, Genome Biol. 8:R97(2007)., "Computational and transcriptional evidence for microRNAs in the honey bee genome" |