| Basic information from miRBase |
| hairpin accession number: MI0001583 |
| Located between position 368549 and 368639 on chromosome Group10.29 strand + |
| mature miRNAs for MI0001583: |
| ame-miR-263 (MIMAT0001479): GTAAATGGCACTGGAAGAATTCAC |
| You can find this miRNA in ENTREZGENE: Mir263 (accession: 732499) |
| References |
| [1]Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG, Genome Biol. 8:R97(2007)., "Computational and transcriptional evidence for microRNAs in the honey bee genome" |